Book a Demo!
CoCalc Logo Icon
StoreFeaturesDocsShareSupportNewsAboutPoliciesSign UpSign In
huggingface
GitHub Repository: huggingface/notebooks
Path: blob/main/examples/nucleotide_transformer_dna_sequence_modelling.ipynb
5906 views
Kernel: Python 3

If you're opening this Notebook on colab, you will probably need to install 🤗 Transformers as well as some other libraries. Uncomment the following cell and run it.

# Install !pip install -q biopython transformers datasets huggingface_hub accelerate

If you're opening this notebook locally, make sure your environment has an install from the last version of those libraries.

To be able to share your model with the community and generate results like the one shown in the picture below via the inference API, there are a few more steps to follow.

First you have to login to the huggingface hub

from huggingface_hub import notebook_login notebook_login()

Then you need to install Git-LFS. Uncomment the following instructions:

!apt install git-lfs
Reading package lists... Done Building dependency tree Reading state information... Done git-lfs is already the newest version (2.9.2-1). 0 upgraded, 0 newly installed, 0 to remove and 16 not upgraded.

We also quickly upload some telemetry - this tells us which examples and software versions are getting used so we know where to prioritize our maintenance efforts. We don't collect (or care about) any personally identifiable information, but if you'd prefer not to be counted, feel free to skip this step or delete this cell entirely.

from transformers.utils import send_example_telemetry send_example_telemetry("nucleotide_transformer_dna_sequence_modeling_notebook", framework="pytorch")

Fine-Tuning the Nucleotide-transformer

The Nucleotide Transformer paper Dalla-torre et al, 2023 introduces 4 genomics foundational models developed by InstaDeep. These transformers, of various sizes and trained on different datasets, allow powerful representations of DNA sequences that allow to tackle a very diverse set of problems such as chromatin accessibility, deleteriousness prediction, promoter and enhancer prediction etc... These representations can be extracted from the transformer and used as proxies of the DNA sequences (this is called probing) or the transformer can be trained further on a specific task (this is called finetuning).

Figure_1.png

This notebook allows you to fine-tune these models.

The model we are going to use is the 500M Human Ref model, which is a 500M parameters transformer pre-trained on the human reference genome, per the training methodology presented in the Nucleotide Transformer Paper. It is one of the 4 models introduced, all available on the Instadeep HuggingFace page:

| Model name | Num layers | Num parameters | Training dataset | |---------------------|------------|----------------|------------------------| | `500M Human Ref` | 24 | 500M | Human reference genome | | `500M 1000G` | 24 | 500M | 1000G genomes | | `2.5B 1000G` | 32 | 2.5B | 1000G genomes | | `2.5B Multispecies` | 32 | 2.5B | Multi-species dataset |

Note that using the larger models will require more GPU memory and produce longer finetuning times

In the following, we showcase the nucleotide transformer ability to classify genomic sequences as two of the most basic genomic motifs: promoters and enhancers types. Both of them are classification task, but the enhancers types task is much more challenging with its 3 classes.

These two tasks are still very basic, but the nucleotide transformers have been shown to beat/match state of the art models on much more complex tasks such as DeepSEA, which, given a DNA sequence, predicts 919 chromatin profiles from a diverse set of human cells and tissues from a single sequence or DeepSTARR, which predicts an enhancer's activity.

Importing required packages

Import and install

# Imports from transformers import AutoTokenizer, TrainingArguments, Trainer, AutoModelForSequenceClassification import torch from sklearn.metrics import matthews_corrcoef, f1_score from sklearn.model_selection import train_test_split import matplotlib.pyplot as plt import numpy as np
from accelerate.test_utils.testing import get_backend device, _, _ = get_backend()

Prepare and create the model for fine-tuning

The nucleotide transformer will be fine-tuned on two classification tasks: promoter and enhancer types classification. The AutoModelForSequenceClassification module automatically loads the model and adds a simple classification head on top of the final embeddings.

First task : Promoter prediction

Promoter prediction is a sequence classification problem, in which the DNA sequence is predicted to be either a promoter or not.

A promoter is a region of DNA where transcription of a gene is initiated. Promoters are a vital component of expression vectors because they control the binding of RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA which is ultimately translated into a functional protein

This task was introduced in DeePromoter, where a set of TATA and non-TATA promoters was gathered. A negative sequence was generated from each promoter, by randomly sampling subsets of the sequence, to guarantee that some obvious motifs were present both in the positive and negative dataset.

num_labels_promoter = 2 # Load the model model = AutoModelForSequenceClassification.from_pretrained("InstaDeepAI/nucleotide-transformer-500m-human-ref", num_labels=num_labels_promoter) model = model.to(device)

Dataset loading and preparation

from datasets import load_dataset, Dataset # Load the promoter dataset from the InstaDeep Hugging Face ressources dataset_name = "promoter_all" train_dataset_promoter = load_dataset( "InstaDeepAI/nucleotide_transformer_downstream_tasks", dataset_name, split="train", streaming= False, ) test_dataset_promoter = load_dataset( "InstaDeepAI/nucleotide_transformer_downstream_tasks", dataset_name, split="test", streaming= False, )
WARNING:datasets.builder:Found cached dataset nucleotide_transformer_downstream_tasks_public (/root/.cache/huggingface/datasets/InstaDeepAI___nucleotide_transformer_downstream_tasks_public/promoter_all/0.0.0/d649d80b49e7b062da8a12a4d80a5d636571467e76a0a036d89078ffded1e5c9) WARNING:datasets.builder:Found cached dataset nucleotide_transformer_downstream_tasks_public (/root/.cache/huggingface/datasets/InstaDeepAI___nucleotide_transformer_downstream_tasks_public/promoter_all/0.0.0/d649d80b49e7b062da8a12a4d80a5d636571467e76a0a036d89078ffded1e5c9)
# Get training data train_sequences_promoter = train_dataset_promoter['sequence'] train_labels_promoter = train_dataset_promoter['label'] # Split the dataset into a training and a validation dataset train_sequences_promoter, validation_sequences_promoter, train_labels_promoter, validation_labels_promoter = train_test_split(train_sequences_promoter, train_labels_promoter, test_size=0.05, random_state=42) # Get test data test_sequences_promoter = test_dataset_promoter['sequence'] test_labels_promoter = test_dataset_promoter['label']

Let us have a look at the data. If we extract the last sequence of the dataset, we see that it is indeed a promoter, as its label is 1. Furthermore, we can also see that it is a TATA promoter, as the TATA motif is present at the 221th nucleotide of the sequence!

idx_sequence = -1 sequence, label = train_sequences_promoter[idx_sequence], train_labels_promoter[idx_sequence] print(f"The DNA sequence is {sequence}.") print(f"Its associated label is label {label}.") idx_TATA = sequence.find("TATA") print(f"This promoter is a TATA promoter, as the TATA motif is present at the {idx_TATA}th nucleotide.")
The DNA sequence is CACACCAGACAAAATTTGGTTAATTTGCGCCCAATATTCATTACTTTGACCTAACCTTTGTTCTGAAGGCCGTGTACAAGGACAAGGCCCTGAGATTATTGCAACAGTAACTTGAAAAACTTTCAGAAGTCTATTCTGTAGGATTAAAGGAATGCTGAGACTATTCAAGTTTGAAGTCCTGGGGGTGGGGAAAAATAAAAAACCTGTGCTAGAAAGCTTAGTATAGCATGTAACTTTAGAGTCCTGTGGAGTCCTGAGTCTCCCACAGACCAGAACAGTCATTTAAAAGTTTTCAGGAAA. Its associated label is label 1. This promoter is a TATA promoter, as the TATA motif is present at the 221th nucleotide.

Tokenizing the datasets

All inputs to neural nets must be numerical. The process of converting strings into numerical indices suitable for a neural net is called tokenization.

# Load the tokenizer tokenizer = AutoTokenizer.from_pretrained("InstaDeepAI/nucleotide-transformer-500m-human-ref")
Downloading (…)okenizer_config.json: 0%| | 0.00/129 [00:00<?, ?B/s]
Downloading (…)solve/main/vocab.txt: 0.00B [00:00, ?B/s]
Downloading (…)cial_tokens_map.json: 0%| | 0.00/101 [00:00<?, ?B/s]
# Promoter dataset ds_train_promoter = Dataset.from_dict({"data": train_sequences_promoter,'labels':train_labels_promoter}) ds_validation_promoter = Dataset.from_dict({"data": validation_sequences_promoter,'labels':validation_labels_promoter}) ds_test_promoter = Dataset.from_dict({"data": test_sequences_promoter,'labels':test_labels_promoter})
def tokenize_function(examples): outputs = tokenizer(examples["data"]) return outputs
# Creating tokenized promoter dataset tokenized_datasets_train_promoter = ds_train_promoter.map( tokenize_function, batched=True, remove_columns=["data"], ) tokenized_datasets_validation_promoter = ds_validation_promoter.map( tokenize_function, batched=True, remove_columns=["data"], ) tokenized_datasets_test_promoter = ds_test_promoter.map( tokenize_function, batched=True, remove_columns=["data"], )
Map: 0%| | 0/50612 [00:00<?, ? examples/s]
Map: 0%| | 0/2664 [00:00<?, ? examples/s]
Map: 0%| | 0/5920 [00:00<?, ? examples/s]

Fine-tuning and evaluation

The hyper-parameters introduced here are different from the ones used in the paper since we are training the whole model. Further hyper-parameters search will surely improve the performance on the task!. We initialize our TrainingArguments. These control the various training hyperparameters, and will be passed to our Trainer.

batch_size = 8 model_name='nucleotide-transformer' args_promoter = TrainingArguments( f"{model_name}-finetuned-NucleotideTransformer", remove_unused_columns=False, eval_strategy="steps", save_strategy="steps", learning_rate=1e-5, per_device_train_batch_size=batch_size, gradient_accumulation_steps= 1, per_device_eval_batch_size= 64, num_train_epochs= 2, logging_steps= 100, load_best_model_at_end=True, # Keep the best model according to the evaluation metric_for_best_model="f1_score", label_names=["labels"], dataloader_drop_last=True, max_steps= 1000 )

Next, we define the metric we will use to evaluate our models and write a compute_metrics function. We can load this from the scikit-learn library.

# Define the metric for the evaluation using the f1 score def compute_metrics_f1_score(eval_pred): """Computes F1 score for binary classification""" predictions = np.argmax(eval_pred.predictions, axis=-1) references = eval_pred.label_ids r={'f1_score': f1_score(references, predictions)} return r
trainer = Trainer( model.to(device), args_promoter, train_dataset= tokenized_datasets_train_promoter, eval_dataset= tokenized_datasets_validation_promoter, tokenizer=tokenizer, compute_metrics=compute_metrics_f1_score, )

We can now finetune our model by just calling the train method:

train_results = trainer.train()
/usr/local/lib/python3.10/dist-packages/transformers/optimization.py:411: FutureWarning: This implementation of AdamW is deprecated and will be removed in a future version. Use the PyTorch implementation torch.optim.AdamW instead, or set `no_deprecation_warning=True` to disable this warning warnings.warn(

Note that the finetuning is done with a small batch size (8). The training time can be reduced by increasing the batch size, as it leverages parallelism in the GPU.

Validation F1 score

curve_evaluation_f1_score =[[a['step'],a['eval_f1_score']] for a in trainer.state.log_history if 'eval_f1_score' in a.keys()] eval_f1_score = [c[1] for c in curve_evaluation_f1_score] steps = [c[0] for c in curve_evaluation_f1_score]
plt.plot(steps, eval_f1_score, 'b', label='Validation F1 score') plt.title('Validation F1 score for promoter prediction') plt.xlabel('Number of training steps performed') plt.ylabel('Validation F1 score') plt.legend() plt.show()
Image in a Jupyter notebook

F1 score on the test dataset

# Compute the F1 score on the test dataset : print(f"F1 score on the test dataset: {trainer.predict(tokenized_datasets_test_promoter).metrics['test_f1_score']}")
F1 score on the test dataset: 0.9388458225667529

For the promoter prediction task, we obtain a perforance that is already close to the one displayed in the article by training on only 1000 steps. A F1 score of 0.938 is obtained after just 1000 training steps. To get closer to the 0.954 score obtained in the nucleotide transformer paper after 10,000 training steps, we surely need to train for longer!

Second task : Enhancer type prediction

In this section, we fine-tune the nucleotide transformer model on enhancer type prediction, which consists in classifying a DNA sequence as strong, weak or non enhancer.

In genetics, an enhancer is a short (50–1500 bp) region of DNA that can be bound by proteins (activators) to increase the likelihood that transcription of a particular gene will occur.

A deep learning framework for enhancer prediction using word embedding and sequence generation introduced the dataset used here by augmenting an original set of enhancers with 6000 synthetic enhancers and 6000 synthetic non-enhancers produced through a generative model.

Model

num_labels_enhancers_types = 3 # Load the model model = AutoModelForSequenceClassification.from_pretrained("InstaDeepAI/nucleotide-transformer-500m-human-ref", num_labels=num_labels_enhancers_types) model = model.to(device)
Some weights of the model checkpoint at InstaDeepAI/nucleotide-transformer-500m-human-ref were not used when initializing EsmForSequenceClassification: ['lm_head.layer_norm.weight', 'lm_head.layer_norm.bias', 'lm_head.dense.bias', 'lm_head.dense.weight', 'lm_head.decoder.weight', 'lm_head.bias'] - This IS expected if you are initializing EsmForSequenceClassification from the checkpoint of a model trained on another task or with another architecture (e.g. initializing a BertForSequenceClassification model from a BertForPreTraining model). - This IS NOT expected if you are initializing EsmForSequenceClassification from the checkpoint of a model that you expect to be exactly identical (initializing a BertForSequenceClassification model from a BertForSequenceClassification model). Some weights of EsmForSequenceClassification were not initialized from the model checkpoint at InstaDeepAI/nucleotide-transformer-500m-human-ref and are newly initialized: ['classifier.out_proj.bias', 'classifier.dense.bias', 'classifier.dense.weight', 'classifier.out_proj.weight'] You should probably TRAIN this model on a down-stream task to be able to use it for predictions and inference.

Dataset loading and preparation

from datasets import load_dataset, Dataset # Load the enhancers dataset from the InstaDeep Hugging Face ressources dataset_name = "enhancers_types" train_dataset_enhancers = load_dataset( "InstaDeepAI/nucleotide_transformer_downstream_tasks", dataset_name, split="train", streaming= False, ) test_dataset_enhancers = load_dataset( "InstaDeepAI/nucleotide_transformer_downstream_tasks", dataset_name, split="test", streaming= False, )
WARNING:datasets.builder:Found cached dataset nucleotide_transformer_downstream_tasks (/root/.cache/huggingface/datasets/InstaDeepAI___nucleotide_transformer_downstream_tasks/enhancers_types/0.0.0/4a78b0644424e03fb4f26af3966a46e57ea50a1132ab8bb2f63b7808ce6a8772) WARNING:datasets.builder:Found cached dataset nucleotide_transformer_downstream_tasks (/root/.cache/huggingface/datasets/InstaDeepAI___nucleotide_transformer_downstream_tasks/enhancers_types/0.0.0/4a78b0644424e03fb4f26af3966a46e57ea50a1132ab8bb2f63b7808ce6a8772)
# Get training data train_sequences_enhancers = train_dataset_enhancers['sequence'] train_labels_enhancers = train_dataset_enhancers['label'] # Split the dataset into a training and a validation dataset train_sequences_enhancers, validation_sequences_enhancers, train_labels_enhancers, validation_labels_enhancers = train_test_split(train_sequences_enhancers, train_labels_enhancers, test_size=0.10, random_state=42)
# Get test data test_sequences_enhancers = test_dataset_enhancers['sequence'] test_labels_enhancers = test_dataset_enhancers['label']

Tokenizing the datasets

# Enhancer dataset ds_train_enhancers = Dataset.from_dict({"data": train_sequences_enhancers,'labels':train_labels_enhancers}) ds_validation_enhancers = Dataset.from_dict({"data": validation_sequences_enhancers,'labels':validation_labels_enhancers}) ds_test_enhancers = Dataset.from_dict({"data": test_sequences_enhancers,'labels':test_labels_enhancers})
# Creating tokenized enhancer dataset tokenized_datasets_train_enhancers = ds_train_enhancers.map( tokenize_function, batched=True, remove_columns=["data"], ) tokenized_datasets_validation_enhancers = ds_validation_enhancers.map( tokenize_function, batched=True, remove_columns=["data"], ) tokenized_datasets_test_enhancers = ds_test_enhancers.map( tokenize_function, batched=True, remove_columns=["data"], )
Map: 0%| | 0/13471 [00:00<?, ? examples/s]
Map: 0%| | 0/1497 [00:00<?, ? examples/s]
Map: 0%| | 0/400 [00:00<?, ? examples/s]

Fine-tuning and evaluation

As with the promoters task, the hyper-parameters introduced here are different from the ones used in the paper since we are training the whole model. Further hyper-parameters search will surely improve the performance on the task!. We initialize our TrainingArguments. These control the various training hyperparameters, and will be passed to our Trainer.

batch_size = 8 model_name='nucleotide-transformer' args_enhancers = TrainingArguments( f"{model_name}-finetuned-NucleotideTransformer", remove_unused_columns=False, eval_strategy="steps", save_strategy="steps", learning_rate=1e-5, per_device_train_batch_size=batch_size, gradient_accumulation_steps= 1, per_device_eval_batch_size= 64, num_train_epochs= 2, logging_steps= 100, load_best_model_at_end=True, # Keep the best model according to the evaluation metric_for_best_model="mcc_score", # The mcc_score on the evaluation dataset used to select the best model label_names=["labels"], dataloader_drop_last=True, max_steps= 1000 )

Here, the metric used to evaluate the model is the Matthews Correlation Coefficient, which is more relevant than the accuracy when the classes in the dataset are unbalanced. We can load a predefined function from the scikit-learn library.

# Define the metric for the evaluation def compute_metrics_mcc(eval_pred): """Computes Matthews correlation coefficient (MCC score) for binary classification""" predictions = np.argmax(eval_pred.predictions, axis=-1) references = eval_pred.label_ids r={'mcc_score': matthews_corrcoef(references, predictions)} return r
trainer = Trainer( model, args_enhancers, train_dataset= tokenized_datasets_train_enhancers, eval_dataset= tokenized_datasets_validation_enhancers, tokenizer=tokenizer, compute_metrics=compute_metrics_mcc, )

We can now finetune our model by just calling the train method:

train_results = trainer.train()
/usr/local/lib/python3.10/dist-packages/transformers/optimization.py:411: FutureWarning: This implementation of AdamW is deprecated and will be removed in a future version. Use the PyTorch implementation torch.optim.AdamW instead, or set `no_deprecation_warning=True` to disable this warning warnings.warn(

As with the first task, the time can be greatly reduced by increasing the batch size.

Validation MCC score

curve_evaluation_mcc_score=[[a['step'],a['eval_mcc_score']] for a in trainer.state.log_history if 'eval_mcc_score' in a.keys()] eval_mcc_score = [c[1] for c in curve_evaluation_mcc_score] steps = [c[0] for c in curve_evaluation_mcc_score]
plt.plot(steps, eval_mcc_score, 'b', label='Validation MCC score') plt.title('Validation MCC score for enhancer prediction') plt.xlabel('Number of training steps performed') plt.ylabel('Validation MCC score') plt.legend() plt.show()
Image in a Jupyter notebook

MCC on the test dataset

# Compute the MCC score on the test dataset : print(f"MCC score on the test dataset: {trainer.predict(tokenized_datasets_test_enhancers).metrics['test_mcc_score']}")
MCC score on the test dataset: 0.39976156802970286

For the enhancers types prediction task, we obtain a perforance after 1000 training steps that is 0.40, which is already beating the baseline on which Nucleotide Transformer is compared (0.395). This is still, however, 8.5 percent points below its performance (0.485) in the Nucleotide Transformers paper. To match the paper results more closely, it will probably be necessary to increase the number of training steps. Also note that the paper used a parameter-efficient finetuning method called IA3, whereas in this notebook we fine-tuned the entire model for simplicity.

Conclusion

This notebook showcases the simple approach required to finetune a Nucleotide Transformer model on any classification task. For the sake of simplicity, a standard approach has been used where the whole model is finetuned on the new dataset, which is a different approach than what was used to tackle the different downstream tasks presented in the paper!